ID: 938940790

View in Genome Browser
Species Human (GRCh38)
Location 2:136167998-136168020
Sequence AGGCTGTGCCTGAAAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940786_938940790 -1 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940790 2:136167998-136168020 AGGCTGTGCCTGAAAGATGCTGG No data
938940785_938940790 0 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940790 2:136167998-136168020 AGGCTGTGCCTGAAAGATGCTGG No data
938940783_938940790 20 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940790 2:136167998-136168020 AGGCTGTGCCTGAAAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940790 Original CRISPR AGGCTGTGCCTGAAAGATGC TGG Intergenic
No off target data available for this crispr