ID: 938940791

View in Genome Browser
Species Human (GRCh38)
Location 2:136167999-136168021
Sequence GGCTGTGCCTGAAAGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940783_938940791 21 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940791 2:136167999-136168021 GGCTGTGCCTGAAAGATGCTGGG No data
938940786_938940791 0 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940791 2:136167999-136168021 GGCTGTGCCTGAAAGATGCTGGG No data
938940785_938940791 1 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940791 2:136167999-136168021 GGCTGTGCCTGAAAGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940791 Original CRISPR GGCTGTGCCTGAAAGATGCT GGG Intergenic
No off target data available for this crispr