ID: 938940794

View in Genome Browser
Species Human (GRCh38)
Location 2:136168006-136168028
Sequence CCTGAAAGATGCTGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940783_938940794 28 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940788_938940794 -6 Left 938940788 2:136167989-136168011 CCCTGCAGCAGGCTGTGCCTGAA No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940785_938940794 8 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940786_938940794 7 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940789_938940794 -7 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940794 Original CRISPR CCTGAAAGATGCTGGGCAGA GGG Intergenic
No off target data available for this crispr