ID: 938940795

View in Genome Browser
Species Human (GRCh38)
Location 2:136168019-136168041
Sequence GGGCAGAGGGAGAACCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940785_938940795 21 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data
938940793_938940795 -10 Left 938940793 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data
938940789_938940795 6 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data
938940788_938940795 7 Left 938940788 2:136167989-136168011 CCCTGCAGCAGGCTGTGCCTGAA No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data
938940786_938940795 20 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940795 Original CRISPR GGGCAGAGGGAGAACCAGAT AGG Intergenic
No off target data available for this crispr