ID: 938942379

View in Genome Browser
Species Human (GRCh38)
Location 2:136180564-136180586
Sequence CCTTAAGTATTGTACCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938942376_938942379 12 Left 938942376 2:136180529-136180551 CCCATGAGCTCATGAGAATAAAA No data
Right 938942379 2:136180564-136180586 CCTTAAGTATTGTACCAGCAAGG No data
938942377_938942379 11 Left 938942377 2:136180530-136180552 CCATGAGCTCATGAGAATAAAAA No data
Right 938942379 2:136180564-136180586 CCTTAAGTATTGTACCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938942379 Original CRISPR CCTTAAGTATTGTACCAGCA AGG Intergenic
No off target data available for this crispr