ID: 938942990

View in Genome Browser
Species Human (GRCh38)
Location 2:136185897-136185919
Sequence ATGAAACCCAGGAGAGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938942990_938942997 25 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938942997 2:136185945-136185967 GGGATGACAGCCGCTTGTCTTGG No data
938942990_938942998 26 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938942998 2:136185946-136185968 GGATGACAGCCGCTTGTCTTGGG No data
938942990_938942994 3 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938942994 2:136185923-136185945 AGCTAGAGGTTATGGCAGTCTGG No data
938942990_938942999 27 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938942999 2:136185947-136185969 GATGACAGCCGCTTGTCTTGGGG No data
938942990_938942993 -5 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938942993 2:136185915-136185937 TTCATTTCAGCTAGAGGTTATGG No data
938942990_938942996 5 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938942996 2:136185925-136185947 CTAGAGGTTATGGCAGTCTGGGG No data
938942990_938943000 28 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938943000 2:136185948-136185970 ATGACAGCCGCTTGTCTTGGGGG No data
938942990_938942995 4 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938942995 2:136185924-136185946 GCTAGAGGTTATGGCAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938942990 Original CRISPR ATGAAACCCAGGAGAGACTC AGG (reversed) Intergenic