ID: 938942991

View in Genome Browser
Species Human (GRCh38)
Location 2:136185908-136185930
Sequence CTCTAGCTGAAATGAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938942991_938942995 -7 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938942995 2:136185924-136185946 GCTAGAGGTTATGGCAGTCTGGG No data
938942991_938942997 14 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938942997 2:136185945-136185967 GGGATGACAGCCGCTTGTCTTGG No data
938942991_938942999 16 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938942999 2:136185947-136185969 GATGACAGCCGCTTGTCTTGGGG No data
938942991_938942998 15 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938942998 2:136185946-136185968 GGATGACAGCCGCTTGTCTTGGG No data
938942991_938942994 -8 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938942994 2:136185923-136185945 AGCTAGAGGTTATGGCAGTCTGG No data
938942991_938943000 17 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938943000 2:136185948-136185970 ATGACAGCCGCTTGTCTTGGGGG No data
938942991_938942996 -6 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938942996 2:136185925-136185947 CTAGAGGTTATGGCAGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938942991 Original CRISPR CTCTAGCTGAAATGAAACCC AGG (reversed) Intergenic