ID: 938943000

View in Genome Browser
Species Human (GRCh38)
Location 2:136185948-136185970
Sequence ATGACAGCCGCTTGTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938942991_938943000 17 Left 938942991 2:136185908-136185930 CCTGGGTTTCATTTCAGCTAGAG No data
Right 938943000 2:136185948-136185970 ATGACAGCCGCTTGTCTTGGGGG No data
938942990_938943000 28 Left 938942990 2:136185897-136185919 CCTGAGTCTCTCCTGGGTTTCAT No data
Right 938943000 2:136185948-136185970 ATGACAGCCGCTTGTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938943000 Original CRISPR ATGACAGCCGCTTGTCTTGG GGG Intergenic