ID: 938943620

View in Genome Browser
Species Human (GRCh38)
Location 2:136191039-136191061
Sequence CTTGCTAAGCTGAAGGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938943618_938943620 12 Left 938943618 2:136191004-136191026 CCTATGTACATTTCTCAAAATAT No data
Right 938943620 2:136191039-136191061 CTTGCTAAGCTGAAGGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938943620 Original CRISPR CTTGCTAAGCTGAAGGCTGT TGG Intergenic
No off target data available for this crispr