ID: 938945968

View in Genome Browser
Species Human (GRCh38)
Location 2:136212395-136212417
Sequence GAAGAATAGCCATAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938945968_938945978 24 Left 938945968 2:136212395-136212417 CCATTTTCCTATGGCTATTCTTC No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data
938945968_938945976 5 Left 938945968 2:136212395-136212417 CCATTTTCCTATGGCTATTCTTC No data
Right 938945976 2:136212423-136212445 GGATGTTCTTGGGGACTCCTAGG No data
938945968_938945971 -6 Left 938945968 2:136212395-136212417 CCATTTTCCTATGGCTATTCTTC No data
Right 938945971 2:136212412-136212434 TTCTTCTCCCAGGATGTTCTTGG No data
938945968_938945972 -5 Left 938945968 2:136212395-136212417 CCATTTTCCTATGGCTATTCTTC No data
Right 938945972 2:136212413-136212435 TCTTCTCCCAGGATGTTCTTGGG No data
938945968_938945973 -4 Left 938945968 2:136212395-136212417 CCATTTTCCTATGGCTATTCTTC No data
Right 938945973 2:136212414-136212436 CTTCTCCCAGGATGTTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938945968 Original CRISPR GAAGAATAGCCATAGGAAAA TGG (reversed) Intergenic