ID: 938945969

View in Genome Browser
Species Human (GRCh38)
Location 2:136212402-136212424
Sequence CCTGGGAGAAGAATAGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938945969_938945979 29 Left 938945969 2:136212402-136212424 CCTATGGCTATTCTTCTCCCAGG No data
Right 938945979 2:136212454-136212476 TCTGACCCAGGACATCAGCCTGG No data
938945969_938945976 -2 Left 938945969 2:136212402-136212424 CCTATGGCTATTCTTCTCCCAGG No data
Right 938945976 2:136212423-136212445 GGATGTTCTTGGGGACTCCTAGG No data
938945969_938945978 17 Left 938945969 2:136212402-136212424 CCTATGGCTATTCTTCTCCCAGG No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938945969 Original CRISPR CCTGGGAGAAGAATAGCCAT AGG (reversed) Intergenic