ID: 938945974

View in Genome Browser
Species Human (GRCh38)
Location 2:136212419-136212441
Sequence GGAGTCCCCAAGAACATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938945974_938945982 21 Left 938945974 2:136212419-136212441 CCCAGGATGTTCTTGGGGACTCC No data
Right 938945982 2:136212463-136212485 GGACATCAGCCTGGTTACTGTGG No data
938945974_938945979 12 Left 938945974 2:136212419-136212441 CCCAGGATGTTCTTGGGGACTCC No data
Right 938945979 2:136212454-136212476 TCTGACCCAGGACATCAGCCTGG No data
938945974_938945978 0 Left 938945974 2:136212419-136212441 CCCAGGATGTTCTTGGGGACTCC No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938945974 Original CRISPR GGAGTCCCCAAGAACATCCT GGG (reversed) Intergenic