ID: 938945975

View in Genome Browser
Species Human (GRCh38)
Location 2:136212420-136212442
Sequence AGGAGTCCCCAAGAACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938945975_938945979 11 Left 938945975 2:136212420-136212442 CCAGGATGTTCTTGGGGACTCCT No data
Right 938945979 2:136212454-136212476 TCTGACCCAGGACATCAGCCTGG No data
938945975_938945982 20 Left 938945975 2:136212420-136212442 CCAGGATGTTCTTGGGGACTCCT No data
Right 938945982 2:136212463-136212485 GGACATCAGCCTGGTTACTGTGG No data
938945975_938945978 -1 Left 938945975 2:136212420-136212442 CCAGGATGTTCTTGGGGACTCCT No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938945975 Original CRISPR AGGAGTCCCCAAGAACATCC TGG (reversed) Intergenic