ID: 938945978

View in Genome Browser
Species Human (GRCh38)
Location 2:136212442-136212464
Sequence TAGGCTTGCTACTCTGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938945975_938945978 -1 Left 938945975 2:136212420-136212442 CCAGGATGTTCTTGGGGACTCCT No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data
938945968_938945978 24 Left 938945968 2:136212395-136212417 CCATTTTCCTATGGCTATTCTTC No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data
938945974_938945978 0 Left 938945974 2:136212419-136212441 CCCAGGATGTTCTTGGGGACTCC No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data
938945969_938945978 17 Left 938945969 2:136212402-136212424 CCTATGGCTATTCTTCTCCCAGG No data
Right 938945978 2:136212442-136212464 TAGGCTTGCTACTCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938945978 Original CRISPR TAGGCTTGCTACTCTGACCC AGG Intergenic