ID: 938945979

View in Genome Browser
Species Human (GRCh38)
Location 2:136212454-136212476
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938945969_938945979 29 Left 938945969 2:136212402-136212424 CCTATGGCTATTCTTCTCCCAGG No data
Right 938945979 2:136212454-136212476 TCTGACCCAGGACATCAGCCTGG No data
938945974_938945979 12 Left 938945974 2:136212419-136212441 CCCAGGATGTTCTTGGGGACTCC No data
Right 938945979 2:136212454-136212476 TCTGACCCAGGACATCAGCCTGG No data
938945975_938945979 11 Left 938945975 2:136212420-136212442 CCAGGATGTTCTTGGGGACTCCT No data
Right 938945979 2:136212454-136212476 TCTGACCCAGGACATCAGCCTGG No data
938945977_938945979 -9 Left 938945977 2:136212440-136212462 CCTAGGCTTGCTACTCTGACCCA No data
Right 938945979 2:136212454-136212476 TCTGACCCAGGACATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type