ID: 938945982

View in Genome Browser
Species Human (GRCh38)
Location 2:136212463-136212485
Sequence GGACATCAGCCTGGTTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938945975_938945982 20 Left 938945975 2:136212420-136212442 CCAGGATGTTCTTGGGGACTCCT No data
Right 938945982 2:136212463-136212485 GGACATCAGCCTGGTTACTGTGG No data
938945977_938945982 0 Left 938945977 2:136212440-136212462 CCTAGGCTTGCTACTCTGACCCA No data
Right 938945982 2:136212463-136212485 GGACATCAGCCTGGTTACTGTGG No data
938945974_938945982 21 Left 938945974 2:136212419-136212441 CCCAGGATGTTCTTGGGGACTCC No data
Right 938945982 2:136212463-136212485 GGACATCAGCCTGGTTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938945982 Original CRISPR GGACATCAGCCTGGTTACTG TGG Intergenic