ID: 938951045

View in Genome Browser
Species Human (GRCh38)
Location 2:136254758-136254780
Sequence GAGAAAGAACCTGTAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938951045_938951048 0 Left 938951045 2:136254758-136254780 CCTGCAGCTACAGGTTCTTTCTC No data
Right 938951048 2:136254781-136254803 AGTGTGATCTTAATGAGGTAGGG No data
938951045_938951050 19 Left 938951045 2:136254758-136254780 CCTGCAGCTACAGGTTCTTTCTC No data
Right 938951050 2:136254800-136254822 AGGGAGATGGAGTGATGTTGCGG No data
938951045_938951049 6 Left 938951045 2:136254758-136254780 CCTGCAGCTACAGGTTCTTTCTC No data
Right 938951049 2:136254787-136254809 ATCTTAATGAGGTAGGGAGATGG No data
938951045_938951046 -5 Left 938951045 2:136254758-136254780 CCTGCAGCTACAGGTTCTTTCTC No data
Right 938951046 2:136254776-136254798 TTCTCAGTGTGATCTTAATGAGG No data
938951045_938951047 -1 Left 938951045 2:136254758-136254780 CCTGCAGCTACAGGTTCTTTCTC No data
Right 938951047 2:136254780-136254802 CAGTGTGATCTTAATGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938951045 Original CRISPR GAGAAAGAACCTGTAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr