ID: 938951047

View in Genome Browser
Species Human (GRCh38)
Location 2:136254780-136254802
Sequence CAGTGTGATCTTAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938951045_938951047 -1 Left 938951045 2:136254758-136254780 CCTGCAGCTACAGGTTCTTTCTC No data
Right 938951047 2:136254780-136254802 CAGTGTGATCTTAATGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938951047 Original CRISPR CAGTGTGATCTTAATGAGGT AGG Intergenic
No off target data available for this crispr