ID: 938953985

View in Genome Browser
Species Human (GRCh38)
Location 2:136281934-136281956
Sequence CGAAAGCTGCAGAGCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938953985_938953993 26 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953993 2:136281983-136282005 CCGTGGGATGCTGCTGCCCAGGG No data
938953985_938953988 9 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953988 2:136281966-136281988 ATCCATCTGGAAAACTGCCGTGG No data
938953985_938953995 28 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953995 2:136281985-136282007 GTGGGATGCTGCTGCCCAGGGGG No data
938953985_938953989 10 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953989 2:136281967-136281989 TCCATCTGGAAAACTGCCGTGGG No data
938953985_938953991 25 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG No data
938953985_938953987 -4 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953987 2:136281953-136281975 TTCGACGCAGCTCATCCATCTGG No data
938953985_938953994 27 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953994 2:136281984-136282006 CGTGGGATGCTGCTGCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938953985 Original CRISPR CGAAAGCTGCAGAGCAGACA GGG (reversed) Intergenic
No off target data available for this crispr