ID: 938953990

View in Genome Browser
Species Human (GRCh38)
Location 2:136281968-136281990
Sequence TCCCACGGCAGTTTTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938953990_938953998 2 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953998 2:136281993-136282015 CTGCTGCCCAGGGGGCTGAGGGG No data
938953990_938953991 -9 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG No data
938953990_938953993 -8 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953993 2:136281983-136282005 CCGTGGGATGCTGCTGCCCAGGG No data
938953990_938953997 1 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953997 2:136281992-136282014 GCTGCTGCCCAGGGGGCTGAGGG No data
938953990_938954001 17 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938954001 2:136282008-136282030 CTGAGGGGTCTCATCGATCTTGG No data
938953990_938953994 -7 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953994 2:136281984-136282006 CGTGGGATGCTGCTGCCCAGGGG No data
938953990_938953996 0 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953996 2:136281991-136282013 TGCTGCTGCCCAGGGGGCTGAGG No data
938953990_938954002 18 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938954002 2:136282009-136282031 TGAGGGGTCTCATCGATCTTGGG No data
938953990_938953995 -6 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953995 2:136281985-136282007 GTGGGATGCTGCTGCCCAGGGGG No data
938953990_938954003 19 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938954003 2:136282010-136282032 GAGGGGTCTCATCGATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938953990 Original CRISPR TCCCACGGCAGTTTTCCAGA TGG (reversed) Intergenic
No off target data available for this crispr