ID: 938953991

View in Genome Browser
Species Human (GRCh38)
Location 2:136281982-136282004
Sequence GCCGTGGGATGCTGCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938953985_938953991 25 Left 938953985 2:136281934-136281956 CCCTGTCTGCTCTGCAGCTTTCG No data
Right 938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG No data
938953990_938953991 -9 Left 938953990 2:136281968-136281990 CCATCTGGAAAACTGCCGTGGGA No data
Right 938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG No data
938953986_938953991 24 Left 938953986 2:136281935-136281957 CCTGTCTGCTCTGCAGCTTTCGA No data
Right 938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938953991 Original CRISPR GCCGTGGGATGCTGCTGCCC AGG Intergenic
No off target data available for this crispr