ID: 938954508

View in Genome Browser
Species Human (GRCh38)
Location 2:136285445-136285467
Sequence CCCTCCCCTCTAGTGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938954504_938954508 6 Left 938954504 2:136285416-136285438 CCTCTGATCTAATGAAAATTATC No data
Right 938954508 2:136285445-136285467 CCCTCCCCTCTAGTGGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938954508 Original CRISPR CCCTCCCCTCTAGTGGTACT TGG Intergenic
No off target data available for this crispr