ID: 938962195

View in Genome Browser
Species Human (GRCh38)
Location 2:136353870-136353892
Sequence ATGTGCCAGGGCCTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938962191_938962195 -7 Left 938962191 2:136353854-136353876 CCTTACCAGACAAGCAATGTGCC No data
Right 938962195 2:136353870-136353892 ATGTGCCAGGGCCTTGATCTTGG No data
938962190_938962195 5 Left 938962190 2:136353842-136353864 CCGATACTGGATCCTTACCAGAC No data
Right 938962195 2:136353870-136353892 ATGTGCCAGGGCCTTGATCTTGG No data
938962189_938962195 17 Left 938962189 2:136353830-136353852 CCATCTTGGAAGCCGATACTGGA No data
Right 938962195 2:136353870-136353892 ATGTGCCAGGGCCTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938962195 Original CRISPR ATGTGCCAGGGCCTTGATCT TGG Intergenic
No off target data available for this crispr