ID: 938964857

View in Genome Browser
Species Human (GRCh38)
Location 2:136379409-136379431
Sequence CTGACTCAGCAGGTCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938964857_938964864 24 Left 938964857 2:136379409-136379431 CCCAGCTAGACCTGCTGAGTCAG No data
Right 938964864 2:136379456-136379478 ATATGTGTTTTAAGATGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938964857 Original CRISPR CTGACTCAGCAGGTCTAGCT GGG (reversed) Intergenic
No off target data available for this crispr