ID: 938966113

View in Genome Browser
Species Human (GRCh38)
Location 2:136389990-136390012
Sequence CCTTATTTGCATCTTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938966109_938966113 -3 Left 938966109 2:136389970-136389992 CCAGCCTGTGCTCTTTAGTTCCT No data
Right 938966113 2:136389990-136390012 CCTTATTTGCATCTTGTGCAGGG No data
938966110_938966113 -7 Left 938966110 2:136389974-136389996 CCTGTGCTCTTTAGTTCCTTATT No data
Right 938966113 2:136389990-136390012 CCTTATTTGCATCTTGTGCAGGG No data
938966108_938966113 3 Left 938966108 2:136389964-136389986 CCTTTGCCAGCCTGTGCTCTTTA No data
Right 938966113 2:136389990-136390012 CCTTATTTGCATCTTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938966113 Original CRISPR CCTTATTTGCATCTTGTGCA GGG Intergenic
No off target data available for this crispr