ID: 938968323

View in Genome Browser
Species Human (GRCh38)
Location 2:136407891-136407913
Sequence TGTGGTTCAAATTGAGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938968323_938968328 17 Left 938968323 2:136407891-136407913 CCACGCTCTCAATTTGAACCACA No data
Right 938968328 2:136407931-136407953 ATTTTTGGCTTTGCTAGTTTGGG No data
938968323_938968329 21 Left 938968323 2:136407891-136407913 CCACGCTCTCAATTTGAACCACA No data
Right 938968329 2:136407935-136407957 TTGGCTTTGCTAGTTTGGGAAGG No data
938968323_938968331 23 Left 938968323 2:136407891-136407913 CCACGCTCTCAATTTGAACCACA No data
Right 938968331 2:136407937-136407959 GGCTTTGCTAGTTTGGGAAGGGG No data
938968323_938968327 16 Left 938968323 2:136407891-136407913 CCACGCTCTCAATTTGAACCACA No data
Right 938968327 2:136407930-136407952 GATTTTTGGCTTTGCTAGTTTGG No data
938968323_938968330 22 Left 938968323 2:136407891-136407913 CCACGCTCTCAATTTGAACCACA No data
Right 938968330 2:136407936-136407958 TGGCTTTGCTAGTTTGGGAAGGG No data
938968323_938968325 2 Left 938968323 2:136407891-136407913 CCACGCTCTCAATTTGAACCACA No data
Right 938968325 2:136407916-136407938 CTTTCTTCCTCATAGATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938968323 Original CRISPR TGTGGTTCAAATTGAGAGCG TGG (reversed) Intergenic
No off target data available for this crispr