ID: 938970517

View in Genome Browser
Species Human (GRCh38)
Location 2:136426868-136426890
Sequence CACAGTGTCTGAATATATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938970517_938970521 -9 Left 938970517 2:136426868-136426890 CCTCTATATATTCAGACACTGTG No data
Right 938970521 2:136426882-136426904 GACACTGTGTTAGGTGCCAGGGG No data
938970517_938970520 -10 Left 938970517 2:136426868-136426890 CCTCTATATATTCAGACACTGTG No data
Right 938970520 2:136426881-136426903 AGACACTGTGTTAGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938970517 Original CRISPR CACAGTGTCTGAATATATAG AGG (reversed) Intergenic
No off target data available for this crispr