ID: 938970521

View in Genome Browser
Species Human (GRCh38)
Location 2:136426882-136426904
Sequence GACACTGTGTTAGGTGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938970517_938970521 -9 Left 938970517 2:136426868-136426890 CCTCTATATATTCAGACACTGTG No data
Right 938970521 2:136426882-136426904 GACACTGTGTTAGGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938970521 Original CRISPR GACACTGTGTTAGGTGCCAG GGG Intergenic
No off target data available for this crispr