ID: 938977977

View in Genome Browser
Species Human (GRCh38)
Location 2:136497361-136497383
Sequence TTTCCTGAAGGGCCATACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938977977_938977980 7 Left 938977977 2:136497361-136497383 CCGGAGTATGGCCCTTCAGGAAA No data
Right 938977980 2:136497391-136497413 TCCTAAGCACTGTTCATTATAGG No data
938977977_938977983 25 Left 938977977 2:136497361-136497383 CCGGAGTATGGCCCTTCAGGAAA No data
Right 938977983 2:136497409-136497431 ATAGGTTGCATAGGATTGAAAGG No data
938977977_938977982 16 Left 938977977 2:136497361-136497383 CCGGAGTATGGCCCTTCAGGAAA No data
Right 938977982 2:136497400-136497422 CTGTTCATTATAGGTTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938977977 Original CRISPR TTTCCTGAAGGGCCATACTC CGG (reversed) Intergenic
No off target data available for this crispr