ID: 938979058

View in Genome Browser
Species Human (GRCh38)
Location 2:136508299-136508321
Sequence TTATAGACAAAGATTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938979058_938979060 9 Left 938979058 2:136508299-136508321 CCGGCCTCAATCTTTGTCTATAA No data
Right 938979060 2:136508331-136508353 AGACACTAAGAGTTTCTGACAGG No data
938979058_938979061 15 Left 938979058 2:136508299-136508321 CCGGCCTCAATCTTTGTCTATAA No data
Right 938979061 2:136508337-136508359 TAAGAGTTTCTGACAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938979058 Original CRISPR TTATAGACAAAGATTGAGGC CGG (reversed) Intergenic
No off target data available for this crispr