ID: 938980548

View in Genome Browser
Species Human (GRCh38)
Location 2:136522233-136522255
Sequence AAGGAGAAGCACAGTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938980548_938980551 -9 Left 938980548 2:136522233-136522255 CCCTTCTCACTGTGCTTCTCCTT No data
Right 938980551 2:136522247-136522269 CTTCTCCTTGCATTGCTTCAGGG No data
938980548_938980550 -10 Left 938980548 2:136522233-136522255 CCCTTCTCACTGTGCTTCTCCTT No data
Right 938980550 2:136522246-136522268 GCTTCTCCTTGCATTGCTTCAGG No data
938980548_938980553 -3 Left 938980548 2:136522233-136522255 CCCTTCTCACTGTGCTTCTCCTT No data
Right 938980553 2:136522253-136522275 CTTGCATTGCTTCAGGGTGCAGG No data
938980548_938980554 4 Left 938980548 2:136522233-136522255 CCCTTCTCACTGTGCTTCTCCTT No data
Right 938980554 2:136522260-136522282 TGCTTCAGGGTGCAGGCCTGTGG No data
938980548_938980555 5 Left 938980548 2:136522233-136522255 CCCTTCTCACTGTGCTTCTCCTT No data
Right 938980555 2:136522261-136522283 GCTTCAGGGTGCAGGCCTGTGGG No data
938980548_938980558 30 Left 938980548 2:136522233-136522255 CCCTTCTCACTGTGCTTCTCCTT No data
Right 938980558 2:136522286-136522308 TCCTTACCTTGATGGCCACTAGG No data
938980548_938980557 22 Left 938980548 2:136522233-136522255 CCCTTCTCACTGTGCTTCTCCTT No data
Right 938980557 2:136522278-136522300 TGTGGGTTTCCTTACCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938980548 Original CRISPR AAGGAGAAGCACAGTGAGAA GGG (reversed) Intergenic
No off target data available for this crispr