ID: 938981436

View in Genome Browser
Species Human (GRCh38)
Location 2:136530890-136530912
Sequence CAGAGTTCCAAGGATGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938981432_938981436 4 Left 938981432 2:136530863-136530885 CCAGGTTGTTGAGGCTAAGGAGA No data
Right 938981436 2:136530890-136530912 CAGAGTTCCAAGGATGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938981436 Original CRISPR CAGAGTTCCAAGGATGGTGC AGG Intergenic
No off target data available for this crispr