ID: 938989004

View in Genome Browser
Species Human (GRCh38)
Location 2:136608871-136608893
Sequence AGCCTCCAGAAGCAGCCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938989004_938989007 18 Left 938989004 2:136608871-136608893 CCCTTAGGCTGCTTCTGGAGGCT No data
Right 938989007 2:136608912-136608934 TTTTTTTTTAAGTTGTTTTATGG No data
938989004_938989008 24 Left 938989004 2:136608871-136608893 CCCTTAGGCTGCTTCTGGAGGCT No data
Right 938989008 2:136608918-136608940 TTTAAGTTGTTTTATGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938989004 Original CRISPR AGCCTCCAGAAGCAGCCTAA GGG (reversed) Intergenic
No off target data available for this crispr