ID: 938993445

View in Genome Browser
Species Human (GRCh38)
Location 2:136653292-136653314
Sequence ATTCTATTCTGTGTGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938993442_938993445 26 Left 938993442 2:136653243-136653265 CCTCAAGAAAAACAAAGTCTAGT No data
Right 938993445 2:136653292-136653314 ATTCTATTCTGTGTGATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938993445 Original CRISPR ATTCTATTCTGTGTGATGAA GGG Intergenic
No off target data available for this crispr