ID: 938994771

View in Genome Browser
Species Human (GRCh38)
Location 2:136666449-136666471
Sequence TGCCCCTCTGTGGCCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938994768_938994771 -9 Left 938994768 2:136666435-136666457 CCAGTTGGGTTGGGTGCCCCTCT No data
Right 938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG No data
938994767_938994771 -8 Left 938994767 2:136666434-136666456 CCCAGTTGGGTTGGGTGCCCCTC No data
Right 938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG No data
938994761_938994771 14 Left 938994761 2:136666412-136666434 CCATAAAACTTTCTCTCAACCTC No data
Right 938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG No data
938994760_938994771 17 Left 938994760 2:136666409-136666431 CCACCATAAAACTTTCTCTCAAC No data
Right 938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG No data
938994766_938994771 -5 Left 938994766 2:136666431-136666453 CCTCCCAGTTGGGTTGGGTGCCC No data
Right 938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG No data
938994759_938994771 20 Left 938994759 2:136666406-136666428 CCTCCACCATAAAACTTTCTCTC No data
Right 938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938994771 Original CRISPR TGCCCCTCTGTGGCCTCCAT GGG Intergenic
No off target data available for this crispr