ID: 938996063

View in Genome Browser
Species Human (GRCh38)
Location 2:136679598-136679620
Sequence CAGAGTAAACAGAAGACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938996058_938996063 19 Left 938996058 2:136679556-136679578 CCCTTAATGTTCACAGATTGGAA No data
Right 938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG No data
938996059_938996063 18 Left 938996059 2:136679557-136679579 CCTTAATGTTCACAGATTGGAAC No data
Right 938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938996063 Original CRISPR CAGAGTAAACAGAAGACTTT TGG Intergenic
No off target data available for this crispr