ID: 939000587

View in Genome Browser
Species Human (GRCh38)
Location 2:136729466-136729488
Sequence GGGTGTGAAACCTAACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939000587_939000594 28 Left 939000587 2:136729466-136729488 CCATGATGTTAGGTTTCACACCC No data
Right 939000594 2:136729517-136729539 AAAGAGAAAGGAGCTTTTTGTGG No data
939000587_939000593 16 Left 939000587 2:136729466-136729488 CCATGATGTTAGGTTTCACACCC No data
Right 939000593 2:136729505-136729527 ACACTTATGTTCAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939000587 Original CRISPR GGGTGTGAAACCTAACATCA TGG (reversed) Intergenic
No off target data available for this crispr