ID: 939001805

View in Genome Browser
Species Human (GRCh38)
Location 2:136745388-136745410
Sequence CTTTCGAGTGGAAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939001805_939001809 -3 Left 939001805 2:136745388-136745410 CCTTCCAACTTTCCACTCGAAAG No data
Right 939001809 2:136745408-136745430 AAGTTCTGAATATGCTTCCTGGG No data
939001805_939001808 -4 Left 939001805 2:136745388-136745410 CCTTCCAACTTTCCACTCGAAAG No data
Right 939001808 2:136745407-136745429 AAAGTTCTGAATATGCTTCCTGG No data
939001805_939001811 25 Left 939001805 2:136745388-136745410 CCTTCCAACTTTCCACTCGAAAG No data
Right 939001811 2:136745436-136745458 TCCCTTCACAAGTCACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939001805 Original CRISPR CTTTCGAGTGGAAAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr