ID: 939007895

View in Genome Browser
Species Human (GRCh38)
Location 2:136810166-136810188
Sequence CGTGCTGCTGCCTGAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939007893_939007895 4 Left 939007893 2:136810139-136810161 CCCTTTCAGTTTTCACTTGTGCT No data
Right 939007895 2:136810166-136810188 CGTGCTGCTGCCTGAGTTCATGG No data
939007894_939007895 3 Left 939007894 2:136810140-136810162 CCTTTCAGTTTTCACTTGTGCTG No data
Right 939007895 2:136810166-136810188 CGTGCTGCTGCCTGAGTTCATGG No data
939007892_939007895 9 Left 939007892 2:136810134-136810156 CCTTTCCCTTTCAGTTTTCACTT No data
Right 939007895 2:136810166-136810188 CGTGCTGCTGCCTGAGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939007895 Original CRISPR CGTGCTGCTGCCTGAGTTCA TGG Intronic
No off target data available for this crispr