ID: 939009678

View in Genome Browser
Species Human (GRCh38)
Location 2:136831405-136831427
Sequence CTGCTATTCAACAGCTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939009678_939009683 18 Left 939009678 2:136831405-136831427 CCCATATAGCTGTTGAATAGCAG No data
Right 939009683 2:136831446-136831468 ATCATCTGGCTTCAGATTTTTGG No data
939009678_939009680 4 Left 939009678 2:136831405-136831427 CCCATATAGCTGTTGAATAGCAG No data
Right 939009680 2:136831432-136831454 TGAGTTCCAACCTAATCATCTGG No data
939009678_939009684 19 Left 939009678 2:136831405-136831427 CCCATATAGCTGTTGAATAGCAG No data
Right 939009684 2:136831447-136831469 TCATCTGGCTTCAGATTTTTGGG No data
939009678_939009685 30 Left 939009678 2:136831405-136831427 CCCATATAGCTGTTGAATAGCAG No data
Right 939009685 2:136831458-136831480 CAGATTTTTGGGCCTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939009678 Original CRISPR CTGCTATTCAACAGCTATAT GGG (reversed) Intronic
No off target data available for this crispr