ID: 939010266

View in Genome Browser
Species Human (GRCh38)
Location 2:136838269-136838291
Sequence AATTGGGTATAGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939010255_939010266 19 Left 939010255 2:136838227-136838249 CCCTGCTTTTCTTAAGATCTGCT No data
Right 939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG No data
939010256_939010266 18 Left 939010256 2:136838228-136838250 CCTGCTTTTCTTAAGATCTGCTT No data
Right 939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG No data
939010260_939010266 -5 Left 939010260 2:136838251-136838273 CCTTGGATTGGGATTATAAATTG No data
Right 939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939010266 Original CRISPR AATTGGGTATAGAGGGAAGG AGG Intronic
No off target data available for this crispr