ID: 939010712

View in Genome Browser
Species Human (GRCh38)
Location 2:136842955-136842977
Sequence TACATTATTCAGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939010712_939010717 -2 Left 939010712 2:136842955-136842977 CCTTGCCCCTTCTGAATAATGTA No data
Right 939010717 2:136842976-136842998 TACTCTAATCAGGTACTGACTGG No data
939010712_939010718 3 Left 939010712 2:136842955-136842977 CCTTGCCCCTTCTGAATAATGTA No data
Right 939010718 2:136842981-136843003 TAATCAGGTACTGACTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939010712 Original CRISPR TACATTATTCAGAAGGGGCA AGG (reversed) Intronic
No off target data available for this crispr