ID: 939011031

View in Genome Browser
Species Human (GRCh38)
Location 2:136846053-136846075
Sequence TAGACTTCCCAAGACGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939011024_939011031 16 Left 939011024 2:136846014-136846036 CCTGTCACTGTCCCTCATCTTGG No data
Right 939011031 2:136846053-136846075 TAGACTTCCCAAGACGAGCAAGG No data
939011029_939011031 4 Left 939011029 2:136846026-136846048 CCTCATCTTGGCTGAGGGATGAC No data
Right 939011031 2:136846053-136846075 TAGACTTCCCAAGACGAGCAAGG No data
939011028_939011031 5 Left 939011028 2:136846025-136846047 CCCTCATCTTGGCTGAGGGATGA No data
Right 939011031 2:136846053-136846075 TAGACTTCCCAAGACGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939011031 Original CRISPR TAGACTTCCCAAGACGAGCA AGG Intronic
No off target data available for this crispr