ID: 939012719

View in Genome Browser
Species Human (GRCh38)
Location 2:136865226-136865248
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939012709_939012719 28 Left 939012709 2:136865175-136865197 CCTCTTGGAGGCATGTCCAGAGA No data
Right 939012719 2:136865226-136865248 AAACCATGCTTCATAGAGAATGG No data
939012718_939012719 -1 Left 939012718 2:136865204-136865226 CCATTTTGGCTAAGGATGTGGGA No data
Right 939012719 2:136865226-136865248 AAACCATGCTTCATAGAGAATGG No data
939012714_939012719 12 Left 939012714 2:136865191-136865213 CCAGAGAAAGGGGCCATTTTGGC No data
Right 939012719 2:136865226-136865248 AAACCATGCTTCATAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr