ID: 939018161

View in Genome Browser
Species Human (GRCh38)
Location 2:136926130-136926152
Sequence ATATACAAGCAAATGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939018161_939018170 16 Left 939018161 2:136926130-136926152 CCTACCTGCATTTGCTTGTATAT No data
Right 939018170 2:136926169-136926191 TCTCCCATGTCTGGGGCAGATGG No data
939018161_939018164 7 Left 939018161 2:136926130-136926152 CCTACCTGCATTTGCTTGTATAT No data
Right 939018164 2:136926160-136926182 TCCCTCCTTTCTCCCATGTCTGG No data
939018161_939018166 8 Left 939018161 2:136926130-136926152 CCTACCTGCATTTGCTTGTATAT No data
Right 939018166 2:136926161-136926183 CCCTCCTTTCTCCCATGTCTGGG No data
939018161_939018168 9 Left 939018161 2:136926130-136926152 CCTACCTGCATTTGCTTGTATAT No data
Right 939018168 2:136926162-136926184 CCTCCTTTCTCCCATGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939018161 Original CRISPR ATATACAAGCAAATGCAGGT AGG (reversed) Intronic
No off target data available for this crispr