ID: 939025569

View in Genome Browser
Species Human (GRCh38)
Location 2:137009719-137009741
Sequence AGTGGAATATAATTGAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939025569_939025579 10 Left 939025569 2:137009719-137009741 CCATAATTCAATTATATTCCACT No data
Right 939025579 2:137009752-137009774 CACAACATGTGGGAATTATCCGG No data
939025569_939025580 11 Left 939025569 2:137009719-137009741 CCATAATTCAATTATATTCCACT No data
Right 939025580 2:137009753-137009775 ACAACATGTGGGAATTATCCGGG No data
939025569_939025573 -1 Left 939025569 2:137009719-137009741 CCATAATTCAATTATATTCCACT No data
Right 939025573 2:137009741-137009763 TGGGTCCCTCCCACAACATGTGG 0: 642
1: 1660
2: 3289
3: 4221
4: 5182
939025569_939025574 0 Left 939025569 2:137009719-137009741 CCATAATTCAATTATATTCCACT No data
Right 939025574 2:137009742-137009764 GGGTCCCTCCCACAACATGTGGG 0: 735
1: 2330
2: 4046
3: 5075
4: 5145
939025569_939025581 12 Left 939025569 2:137009719-137009741 CCATAATTCAATTATATTCCACT No data
Right 939025581 2:137009754-137009776 CAACATGTGGGAATTATCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939025569 Original CRISPR AGTGGAATATAATTGAATTA TGG (reversed) Intronic
No off target data available for this crispr