ID: 939025572

View in Genome Browser
Species Human (GRCh38)
Location 2:137009737-137009759
Sequence ATGTTGTGGGAGGGACCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16674
Summary {0: 635, 1: 2188, 2: 3570, 3: 4909, 4: 5372}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939025572_939025584 21 Left 939025572 2:137009737-137009759 CCACTGGGTCCCTCCCACAACAT 0: 635
1: 2188
2: 3570
3: 4909
4: 5372
Right 939025584 2:137009781-137009803 AATTCAAGATGAGATTTAGGTGG 0: 310
1: 8253
2: 11607
3: 9818
4: 8619
939025572_939025579 -8 Left 939025572 2:137009737-137009759 CCACTGGGTCCCTCCCACAACAT 0: 635
1: 2188
2: 3570
3: 4909
4: 5372
Right 939025579 2:137009752-137009774 CACAACATGTGGGAATTATCCGG No data
939025572_939025583 18 Left 939025572 2:137009737-137009759 CCACTGGGTCCCTCCCACAACAT 0: 635
1: 2188
2: 3570
3: 4909
4: 5372
Right 939025583 2:137009778-137009800 TACAATTCAAGATGAGATTTAGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
939025572_939025580 -7 Left 939025572 2:137009737-137009759 CCACTGGGTCCCTCCCACAACAT 0: 635
1: 2188
2: 3570
3: 4909
4: 5372
Right 939025580 2:137009753-137009775 ACAACATGTGGGAATTATCCGGG No data
939025572_939025581 -6 Left 939025572 2:137009737-137009759 CCACTGGGTCCCTCCCACAACAT 0: 635
1: 2188
2: 3570
3: 4909
4: 5372
Right 939025581 2:137009754-137009776 CAACATGTGGGAATTATCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939025572 Original CRISPR ATGTTGTGGGAGGGACCCAG TGG (reversed) Intronic
Too many off-targets to display for this crispr