ID: 939025579

View in Genome Browser
Species Human (GRCh38)
Location 2:137009752-137009774
Sequence CACAACATGTGGGAATTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939025572_939025579 -8 Left 939025572 2:137009737-137009759 CCACTGGGTCCCTCCCACAACAT 0: 635
1: 2188
2: 3570
3: 4909
4: 5372
Right 939025579 2:137009752-137009774 CACAACATGTGGGAATTATCCGG No data
939025569_939025579 10 Left 939025569 2:137009719-137009741 CCATAATTCAATTATATTCCACT No data
Right 939025579 2:137009752-137009774 CACAACATGTGGGAATTATCCGG No data
939025568_939025579 16 Left 939025568 2:137009713-137009735 CCACTTCCATAATTCAATTATAT No data
Right 939025579 2:137009752-137009774 CACAACATGTGGGAATTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939025579 Original CRISPR CACAACATGTGGGAATTATC CGG Intronic
No off target data available for this crispr