ID: 939028130

View in Genome Browser
Species Human (GRCh38)
Location 2:137038697-137038719
Sequence CAGAAAAGGGTCAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939028124_939028130 2 Left 939028124 2:137038672-137038694 CCTACTACTTCTAGAGATGGCCT No data
Right 939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939028130 Original CRISPR CAGAAAAGGGTCAAGGAGGC AGG Intronic
No off target data available for this crispr