ID: 939028709

View in Genome Browser
Species Human (GRCh38)
Location 2:137044860-137044882
Sequence CAGAATAGTGACATGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939028709_939028712 -2 Left 939028709 2:137044860-137044882 CCTGAATCCATGTCACTATTCTG No data
Right 939028712 2:137044881-137044903 TGTACTTGCAGCAAGTGGCTTGG No data
939028709_939028715 16 Left 939028709 2:137044860-137044882 CCTGAATCCATGTCACTATTCTG No data
Right 939028715 2:137044899-137044921 CTTGGTGTCACTTGTTTCAGGGG 0: 4
1: 4
2: 10
3: 21
4: 189
939028709_939028714 15 Left 939028709 2:137044860-137044882 CCTGAATCCATGTCACTATTCTG No data
Right 939028714 2:137044898-137044920 GCTTGGTGTCACTTGTTTCAGGG 0: 3
1: 4
2: 10
3: 21
4: 166
939028709_939028713 14 Left 939028709 2:137044860-137044882 CCTGAATCCATGTCACTATTCTG No data
Right 939028713 2:137044897-137044919 GGCTTGGTGTCACTTGTTTCAGG 0: 4
1: 4
2: 14
3: 22
4: 168
939028709_939028711 -7 Left 939028709 2:137044860-137044882 CCTGAATCCATGTCACTATTCTG No data
Right 939028711 2:137044876-137044898 TATTCTGTACTTGCAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939028709 Original CRISPR CAGAATAGTGACATGGATTC AGG (reversed) Intronic
No off target data available for this crispr